si:dkeyp-94b4.1

Ensembl ID:
ENSDARG00000038138
ZFIN ID:
ZDB-GENE-081104-483
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIQ7]
Human Orthologue:
SVIL
Human Description:
supervillin [Source:HGNC Symbol;Acc:11480]
Mouse Orthologue:
Svil
Mouse Description:
supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41992 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6243 Nonsense Mutation detected in F1 DNA During 2018
sa35237 Nonsense Mutation detected in F1 DNA During 2018
sa16034 Nonsense Available for shipment Available now
sa35238 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Essential Splice Site 225 1459 5 28
ENSDART00000143924 Essential Splice Site 225 418 6 8
ENSDART00000144727 Essential Splice Site 81 201 5 6
Genomic Location (Zv9):
Chromosome 12 (position 16614972)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15725937
GRCz11 12 15768244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAGGATGCAAGCAACAAGGATGTTGGGAATGCAAGAGATCAAATGG[T/C]AAGCAGTTATTGTACACATCAGTCATTGTACGCAACCTAAATTAAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Nonsense 295 1459 6 28
ENSDART00000143924 Nonsense 295 418 7 8
ENSDART00000144727 Nonsense 151 201 6 6
Genomic Location (Zv9):
Chromosome 12 (position 16618395)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15729360
GRCz11 12 15771667
KASP Assay ID:
554-5168.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGAAGAGCCGTTCAACCAGYCTGGATTTAGAACCTGGTGAAYAAGAG[C/T]GAACCACTATCTGCAAGGAGCTGACTGTTGTTGATGGAAATGAAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Nonsense 601 1459 12 28
ENSDART00000143924   None 418 None 8
ENSDART00000144727   None 201 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16638452)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15749417
GRCz11 12 15791724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGCATCTGCAGTTGAGGAACACAAGCGTTCAGTGCGGCCATGCAGA[C/T]GAGCCAAGAGCTCAAGAAACCCTCTTCGTGCCCTGGCAGCACGAGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Nonsense 799 1459 16 28
ENSDART00000143924   None 418 None 8
ENSDART00000144727   None 201 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16645194)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15756159
GRCz11 12 15798466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCTTGTGTTTTACAGGTGCAGGGGAGCYGGGGGAAGATGAACTCTA[C/A]GAGAGTGCTATAATAGAGTCAAACTGTGTTTATAGGCTGKTGGAGGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055604 Essential Splice Site 896 1459 17 28
ENSDART00000143924   None 418 None 8
ENSDART00000144727   None 201 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16645617)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15756582
GRCz11 12 15798889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGAGTCAACCCCCTTGATCCCTCTTCAGCCAATAAAGACAATGCTAAG[T/C]GAGTGGCATCTTCAATCTTTGTAATTACAGCTTGTATTGGTGATCTACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link