zgc:113411

Ensembl ID:
ENSDARG00000038133
ZFIN ID:
ZDB-GENE-050417-474
Description:
hypothetical protein LOC550611 isoform 1 [Source:RefSeq peptide;Acc:NP_001017912]
Human Orthologues:
SP100, SP140, SP140L
Human Descriptions:
SP100 nuclear antigen [Source:HGNC Symbol;Acc:11206]
SP140 nuclear body protein [Source:HGNC Symbol;Acc:17133]
SP140 nuclear body protein-like [Source:HGNC Symbol;Acc:25105]
Mouse Orthologues:
A530032D15Rik, A530032D15Rik, A630001G21Rik, AC125149.1, AC125149.3, AC125149.7, AC125149.8, AC132444.2, AC132444.3, AC133103.2, AC133103.6, AC168977.2, C130026I21Rik, Sp100, Sp140
Mouse Descriptions:
nuclear antigen Sp100 Gene [Source:MGI Symbol;Acc:MGI:109561]
RIKEN cDNA A530032D15Rik gene Gene [Source:MGI Symbol;Acc:MGI:3037746]
RIKEN cDNA A530032D15Rik gene Gene [Source:MGI Symbol;Acc:MGI:3037746]
RIKEN cDNA A630001G21 gene Gene [Source:MGI Symbol;Acc:MGI:2443131]
RIKEN cDNA C130026I21 gene Gene [Source:MGI Symbol;Acc:MGI:3612702]
Sp140 nuclear body protein Gene [Source:MGI Symbol;Acc:MGI:3702467]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33167 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055590 Nonsense 21 408 1 13
ENSDART00000123994 Nonsense 21 26 2 2
ENSDART00000126230 Nonsense 21 408 2 14
Genomic Location (Zv9):
Chromosome 3 (position 24932961)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24511172
GRCz11 3 24641720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCTGCAAGAAATCACGCCAGATCAGGTCGTCCTCCATCTGCAGCTCC[A/T]AGAGAAAGAAACAAGCTAAAAGCAAAAACTGCCTCCGTGAGTTTGAAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link