si:dkey-65j6.2

Ensembl ID:
ENSDARG00000038119
ZFIN ID:
ZDB-GENE-090313-319
Human Orthologue:
KIAA1755
Human Description:
KIAA1755 [Source:HGNC Symbol;Acc:29372]
Mouse Orthologue:
D630003M21Rik
Mouse Description:
RIKEN cDNA D630003M21 gene Gene [Source:MGI Symbol;Acc:MGI:3606579]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13463 Nonsense Available for shipment Available now
sa11974 Nonsense Available for shipment Available now
sa32467 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055572 Nonsense 282 1588 3 24
ENSDART00000134106   None 120 None 4
ENSDART00000138868   None 172 None 4

The following transcripts of ENSDARG00000038119 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 43581289)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43320266
GRCz11 23 43212870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTAAAAGCAGTTTGGTTGGGATTTGCAACGATCCAMTGGACTTTACC[A/T]AAGAAACCCAAGGATWTGCAAACACATGGACTCCCCTWCTGAGGTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055572 Nonsense 1311 1588 19 24
ENSDART00000134106   None 120 None 4
ENSDART00000138868   None 172 None 4

The following transcripts of ENSDARG00000038119 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 43605840)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43345516
GRCz11 23 43238120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCTAAATCTGAACGAGCAGGGCCAGCTGATTCGGCAGGATGAATTCT[G/A]GGTAATTTTYCGTAAGAAACGTTCCCTCAGGCGAGTGTTTCTCTTCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055572 Nonsense 1530 1588 23 24
ENSDART00000134106   None 120 None 4
ENSDART00000138868 Nonsense 120 172 3 4

The following transcripts of ENSDARG00000038119 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 43614803)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43354483
GRCz11 23 43247087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACGCAGGTTTGACTGGCTGTGCGGATCATACCTGCTCCACAGGACGT[C/T]GAAGGTCATCAGTTTCATCATTGCTTCACTCCAGATCTTCAGCGTCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link