socs1

Ensembl ID:
ENSDARG00000038095
ZFIN ID:
ZDB-GENE-040801-205
Description:
suppressor of cytokine signaling 1 [Source:RefSeq peptide;Acc:NP_001003467]
Human Orthologue:
SOCS1
Human Description:
suppressor of cytokine signaling 1 [Source:HGNC Symbol;Acc:19383]
Mouse Orthologue:
Socs1
Mouse Description:
suppressor of cytokine signaling 1 Gene [Source:MGI Symbol;Acc:MGI:1354910]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40065 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055537 Nonsense 62 201 2 2
Genomic Location (Zv9):
Chromosome 3 (position 26203593)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26683379
GRCz11 3 26814250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCCGTTCAACTATGCAAGAGACTTCAAGATCATTTCCAACACCACCT[C/A]GATGCTAGAGGAGAGTGGCTTTTATTGGGGTCCCATGACTGTGGAGGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link