zgc:56230

Ensembl ID:
ENSDARG00000038094
ZFIN ID:
ZDB-GENE-040426-951
Description:
Zgc:56230 [Source:UniProtKB/TrEMBL;Acc:Q7ZV42]
Human Orthologue:
CLEC16A
Human Description:
C-type lectin domain family 16, member A [Source:HGNC Symbol;Acc:29013]
Mouse Orthologue:
Clec16a
Mouse Description:
C-type lectin domain family 16, member A Gene [Source:MGI Symbol;Acc:MGI:1921624]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10428 Essential Splice Site Available for shipment Available now
sa33176 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11670 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa10428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103690 Essential Splice Site 162 415 4 17
ENSDART00000123609 Essential Splice Site 162 1044 4 23
ENSDART00000123977 Essential Splice Site 162 414 4 18
Genomic Location (Zv9):
Chromosome 3 (position 26114171)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26772801
GRCz11 3 26903672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTCTTTGAAGCTGAACAACCACACCGTTCACTTTTTTTACAATGAGG[T/C]AAGATGCATTTGCTGGGGCAGCTCTCATTTTTTAAATGACAGATCATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103690 Essential Splice Site 355 415 9 17
ENSDART00000123609 Essential Splice Site 352 1044 9 23
ENSDART00000123977 Essential Splice Site 354 414 10 18
Genomic Location (Zv9):
Chromosome 3 (position 26123256)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26763716
GRCz11 3 26894587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCGGTGTTCACCTTACAGACTGAGCAGAGTGCTCACAAGAGTTCAG[T/C]GAGTACATATGTCAGTTGTGATCTTTATTTGAATGTGCATACAGTGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103690 Essential Splice Site None 415 14 17
ENSDART00000123609 Missense 720 1044 19 23
ENSDART00000123977 Essential Splice Site None 414 15 18
Genomic Location (Zv9):
Chromosome 3 (position 26173060)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26713912
GRCz11 3 26844783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCATGGTGGTGAGCAAAGATGGGGTTCAAGCTCAGCGCTTTCTGGCTG[T/A]AGACGTGTACCAGATGAGTCTCGTGGAACCGGATTCAAAGCGTCTTGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link