zgc:66014

Ensembl ID:
ENSDARG00000038043
ZFIN ID:
ZDB-GENE-040426-1507
Description:
LisH domain and HEAT repeat-containing protein KIAA1468 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P
Human Orthologue:
KIAA1468
Human Description:
KIAA1468 [Source:HGNC Symbol;Acc:29289]
Mouse Orthologue:
2310035C23Rik
Mouse Description:
RIKEN cDNA 2310035C23 gene Gene [Source:MGI Symbol;Acc:MGI:1922832]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa609 Nonsense F2 line generated During 2018
sa24473 Nonsense Available for shipment Available now
sa37861 Nonsense Mutation detected in F1 DNA During 2018
sa15052 Nonsense Available for shipment Available now
sa30746 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13951 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa609
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055446 Nonsense 246 1189 5 29
Genomic Location (Zv9):
Chromosome 24 (position 19175028)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18481504
GRCz11 24 18625923
KASP Assay ID:
554-0519.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGAGCCTTAAATTTTTTAGTTAATGAATATTTATTGAAAAACGAATA[C/A]AAGTTAACGTCCATCACATTCTCCGATGAAAACGATGATCAGGTAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055446 Nonsense 444 1189 8 29
Genomic Location (Zv9):
Chromosome 24 (position 19167433)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18473909
GRCz11 24 18618328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACTACTGCTACACAACCTCACAGCAAACTGAAGGCCAATGGTCAG[C/T]AGAGTAAAAGCTCTGTCCAGTTTGACCAGCCCAACAGGTGAGACCTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055446 Nonsense 471 1189 9 29
Genomic Location (Zv9):
Chromosome 24 (position 19164648)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18471124
GRCz11 24 18615543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCAGAAAGCTGTCTCCGGCCTTCCACCAAGCACTTTTGTCCTTCTGT[C/T]GAATGTCTGCTGACAGCAGGCTGGGCTCAGAGGTGAGTGGGATCAGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055446 Nonsense 637 1189 14 29
Genomic Location (Zv9):
Chromosome 24 (position 19114688)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18421164
GRCz11 24 18565583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGGCAGATGATAAAGCTGATATGGTCCGAGAGGCTGTGGTRAAAAGTT[T/A]AGGAGTTATAATGGGTTAYATTGATGATCCAGACAAATACTCCCAGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055446 Essential Splice Site 652 1189 14 29
Genomic Location (Zv9):
Chromosome 24 (position 19114640)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18421116
GRCz11 24 18565535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGGAGTTATAATGGGTTATATTGATGATCCAGACAAATACTCCCAGG[T/C]ATGTATATGTTTACCCACAATCTGGTGTTCTTTCATTAATAATTTCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055446 Essential Splice Site 850 1189 18 29
Genomic Location (Zv9):
Chromosome 24 (position 19106528)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18413004
GRCz11 24 18557423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTGGAGATTATGTCGGACATTTGGGAAAATCTTTACCAACACTAAG[G/A]TACAACTTGCAGGAATCTGTCTCTAKCACCTTTTCTTTTTCTTCATTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link