zgc:110152

Ensembl ID:
ENSDARG00000038025
ZFIN ID:
ZDB-GENE-050417-400
Description:
hypothetical protein LOC550551 [Source:RefSeq peptide;Acc:NP_001017853]
Human Orthologue:
CBX7
Human Description:
chromobox homolog 7 [Source:HGNC Symbol;Acc:1557]
Mouse Orthologue:
Cbx7
Mouse Description:
chromobox homolog 7 Gene [Source:MGI Symbol;Acc:MGI:1196439]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33170 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055428 Nonsense 30 393 2 6
Genomic Location (Zv9):
Chromosome 3 (position 25088718)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24856903
GRCz11 3 24987451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCCTTTCTTCTTTCGCTCTCGTTTCAGGGAAATGTGGAATATCTTT[T/A]AAAGTGGCAAGGATGGTCGCCTAAGTAAGTTGCTCCCCTATTTAGGTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link