zgc:85909

Ensembl ID:
ENSDARG00000038000
ZFIN ID:
ZDB-GENE-040426-2519
Description:
cardiolipin synthase [Source:RefSeq peptide;Acc:NP_998096]
Human Orthologue:
CRLS1
Human Description:
cardiolipin synthase 1 [Source:HGNC Symbol;Acc:16148]
Mouse Orthologue:
Crls1
Mouse Description:
cardiolipin synthase 1 Gene [Source:MGI Symbol;Acc:MGI:1913836]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055385 Nonsense 220 342 3 7
Genomic Location (Zv9):
Chromosome 17 (position 4140172)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4215007
GRCz11 17 4373132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGYGCTCTCGACCCATTGGCTGATAAGATTCTCATCAGCGTTCTTTA[C/A]GTCAGYCTGACATAYGCACAACTCATCCCAGGTGAGAAGACTTAAGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link