tubb5

Ensembl ID:
ENSDARG00000037997
ZFIN ID:
ZDB-GENE-031110-4
Description:
tubulin, beta 5 [Source:RefSeq peptide;Acc:NP_942113]
Human Orthologue:
TUBB
Human Description:
tubulin, beta [Source:HGNC Symbol;Acc:20778]
Mouse Orthologue:
Tubb5
Mouse Description:
tubulin, beta 5 Gene [Source:MGI Symbol;Acc:MGI:107812]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42668 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055380 Essential Splice Site 93 444 3 4
Genomic Location (Zv9):
Chromosome 16 (position 11940856)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10433025
GRCz11 16 10323927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCAGGGCCCTTTGGACAGATCTTCAGACCTGACAACTTTGTATTTGG[T/C]GAGTGACTGATAACAAGTCTATCATCACACAAAAAATCTAATTGACAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link