srrm2

Ensembl ID:
ENSDARG00000037965
ZFIN ID:
ZDB-GENE-050522-399
Description:
Srrm2 protein [Source:UniProtKB/TrEMBL;Acc:Q6IQN3]
Human Orthologue:
SRRM2
Human Description:
serine/arginine repetitive matrix 2 [Source:HGNC Symbol;Acc:16639]
Mouse Orthologue:
Srrm2
Mouse Description:
serine/arginine repetitive matrix 2 Gene [Source:MGI Symbol;Acc:MGI:1923206]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12827 Essential Splice Site Available for shipment Available now
sa2088 Nonsense Available for shipment Available now
sa14000 Nonsense Available for shipment Available now
sa33218 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9943 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055337 Essential Splice Site 177 643 4 10
ENSDART00000129339 Essential Splice Site 63 1168 1 11
ENSDART00000129377 Essential Splice Site 177 1282 3 13
Genomic Location (Zv9):
Chromosome 3 (position 32774586)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32505896
GRCz11 3 32637610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGCAGGAGAGACTGGAACGMGAGAAGCAGCAGCAGCAACAGTAYCAG[T/C]GAGTAGACAGAGAAGAGATTAAAGGGGTGCTATCATGAAAAAKCACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055337 Nonsense 548 643 10 10
ENSDART00000129339 Nonsense 434 1168 7 11
ENSDART00000129377 Nonsense 548 1282 9 13
Genomic Location (Zv9):
Chromosome 3 (position 32779328)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32510638
GRCz11 3 32642352
KASP Assay ID:
554-2515.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTTTCGCCAATGGAAGACAGAAAGAACGAGAACTGGAGAAGGAAAGA[C/T]AAGAACAGCGAGACAGGGAGAAAAGACGAGAGGAGGAGATGAGGGAAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055337   None 643 None 10
ENSDART00000129339 Nonsense 747 1168 7 11
ENSDART00000129377 Nonsense 861 1282 9 13
Genomic Location (Zv9):
Chromosome 3 (position 32780267)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32511577
GRCz11 3 32643291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGAACAAGAGTCGTYACKTCCTTCACCTAGCAGAGGAAGAGATCGA[C/T]AGAGTGACCAAAGGAAAGAGGCACCGCCTTTGTCTCCAAGAGAAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055337   None 643 None 10
ENSDART00000129339 Essential Splice Site 862 1168 7 11
ENSDART00000129377 Essential Splice Site 976 1282 9 13
Genomic Location (Zv9):
Chromosome 3 (position 32780615)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32511925
GRCz11 3 32643639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGAACAGCAGATCAAGGAGTCCCCGAAGACCGAGTCCTCCGTACAGG[T/C]TAGTCAGATGACCAGGTTTTGGAAATGCAAGAGGCAATGGAGACTGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055337   None 643 None 10
ENSDART00000129339 Nonsense 1023 1168 8 11
ENSDART00000129377 Nonsense 1137 1282 10 13
Genomic Location (Zv9):
Chromosome 3 (position 32784233)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32515543
GRCz11 3 32647257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGGGAGGTCGGTTAAGAAGGCAATCCCCAACATCWGTTCATGARCCAT[C/A]AGCAAGAGGAAAGACTGCAGTAAACGGGAAATCAGAGAAAGAGAGCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link