Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rcn3
- Ensembl ID:
- ENSDARG00000037961
- ZFIN ID:
- ZDB-GENE-040625-175
- Description:
- reticulocalbin-3 [Source:RefSeq peptide;Acc:NP_001002158]
- Human Orthologue:
- RCN3
- Human Description:
- reticulocalbin 3, EF-hand calcium binding domain [Source:HGNC Symbol;Acc:21145]
- Mouse Orthologue:
- Rcn3
- Mouse Description:
- reticulocalbin 3, EF-hand calcium binding domain Gene [Source:MGI Symbol;Acc:MGI:1277122]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa15966 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15966
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000055324 | Essential Splice Site | 136 | 316 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 3 (position 32677087)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 32408397 GRCz11 3 32540111 - KASP Assay ID:
- 2259-3665.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAGATCGGATGGATTGAGTACAAGAACACCACCTATGGATATTATATAG[G/A]TAATGAGGCTTTGCGTTTAGGCGTGGSAGCTGGTRATGTTTAATGAGAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
