zgc:112484

Ensembl ID:
ENSDARG00000037943
ZFIN ID:
ZDB-GENE-050417-155
Description:
hypothetical protein LOC550361 [Source:RefSeq peptide;Acc:NP_001017668]
Human Orthologue:
CPT1A
Human Description:
carnitine palmitoyltransferase 1A (liver) [Source:HGNC Symbol;Acc:2328]
Mouse Orthologue:
Cpt1a
Mouse Description:
carnitine palmitoyltransferase 1a, liver Gene [Source:MGI Symbol;Acc:MGI:1098296]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14740 Nonsense Available for shipment Available now
sa31337 Nonsense Available for shipment Available now
sa40093 Nonsense Mutation detected in F1 DNA During 2018
sa38399 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055294 Nonsense 26 780 1 18
ENSDART00000055295 Nonsense 26 170 2 4
Genomic Location (Zv9):
Chromosome 3 (position 32422496)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32153806
GRCz11 3 32285520
KASP Assay ID:
2259-3645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCAGTTCACCATCAGTCCTGAGGGGATCAACCTGCATCTGTCTTAC[C/T]AAGCCCTCAAWCAAATCTACCTCTCCGGATTGCGATCCTGGAAGAAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055294 Nonsense 138 780 3 18
ENSDART00000055295 Nonsense 138 170 4 4
Genomic Location (Zv9):
Chromosome 3 (position 32416423)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32147733
GRCz11 3 32279447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAGGTTCTGCCTGAAGCTTCTCTTGTCCTACCACAGGTGGATGTTT[G/T]AACAACATGGTCATATGTCTACCAAGACCAAAGTGTGGGCGGTTAGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055294 Nonsense 352 780 9 18
ENSDART00000055295   None 170 None 4
Genomic Location (Zv9):
Chromosome 3 (position 32398685)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32129995
GRCz11 3 32261709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTATCACAGAGGCCGTTACTTCAGATTATGGGTCTACCGAGCTGGA[C/T]GATTGCTTTCACCTAGAGAGATCCAATTTCAGATTCAAAGGATTTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055294 Essential Splice Site 713 780 16 18
ENSDART00000055295   None 170 None 4
Genomic Location (Zv9):
Chromosome 3 (position 32376344)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32107654
GRCz11 3 32239368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAGTCAACCACCCAGAGTTCATCTCCCTGGGGGGAGGCTTTGGTCCT[G/T]TGAGTTACTGATCAACACACACATTATCTAAATGTAAATTCCACAAACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link