aldh16a1

Ensembl ID:
ENSDARG00000037935
ZFIN ID:
ZDB-GENE-070112-2062
Description:
aldehyde dehydrogenase family 16 member A1 [Source:RefSeq peptide;Acc:NP_001073423]
Human Orthologue:
ALDH16A1
Human Description:
aldehyde dehydrogenase 16 family, member A1 [Source:HGNC Symbol;Acc:28114]
Mouse Orthologue:
Aldh16a1
Mouse Description:
aldehyde dehydrogenase 16 family, member A1 Gene [Source:MGI Symbol;Acc:MGI:1916998]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44563 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055283 Nonsense 719 780 15 16
ENSDART00000124943 Nonsense 734 795 15 16
Genomic Location (Zv9):
Chromosome 3 (position 32233514)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31964824
GRCz11 3 32096538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCCAGGCACTTGCTAACCACAGCGTGATTCAAGGCATTTGGTATTGG[G/T]GAAGTAAAGAGGTGAGGGAAACAAAATAGAGAAAAGCATGTGCCGGTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link