
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rgs9
- Ensembl ID:
- ENSDARG00000037925
- ZFIN IDs:
- ZDB-GENE-060929-92, ZDB-GENE-060929-92, ZDB-GENE-060929-92, ZDB-GENE-060929-92
- Description:
- hypothetical protein LOC767636 [Source:RefSeq peptide;Acc:NP_001070045]
- Human Orthologue:
- RGS9
- Human Description:
- regulator of G-protein signaling 9 [Source:HGNC Symbol;Acc:10004]
- Mouse Orthologue:
- Rgs9
- Mouse Description:
- regulator of G-protein signaling 9 Gene [Source:MGI Symbol;Acc:MGI:1338824]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33239 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa9502 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33239
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123630 | None | 334 | None | 11 | |
ENSDART00000130128 | Essential Splice Site | 229 | 334 | 11 | 12 |
ENSDART00000130591 | None | 480 | None | 17 | |
ENSDART00000131018 | None | 418 | None | 17 |
- Genomic Location (Zv9):
- Chromosome 3 (position 36385023)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36256307 GRCz11 3 36385707 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAAT[A/T]TAACGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTCTTAGGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9502
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123630 | None | 334 | None | 11 | |
ENSDART00000130128 | Essential Splice Site | 229 | 334 | 11 | 12 |
ENSDART00000130591 | None | 480 | None | 17 | |
ENSDART00000131018 | None | 418 | None | 17 |
- Genomic Location (Zv9):
- Chromosome 3 (position 36385024)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36256308 GRCz11 3 36385708 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTGTGATCTGTATGTTTAGTGAAGTATTTAGAATGGATCTTTTTAATA[T/G]AAYGTAACAGAATTGAACATTTCTGAGCTCTGTATTTCTTNNNNNGTTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: