zgc:113113

Ensembl ID:
ENSDARG00000037913
ZFIN ID:
ZDB-GENE-050320-8
Description:
nicotinamide riboside kinase 1 [Source:RefSeq peptide;Acc:NP_001013467]
Human Orthologue:
C9orf95
Human Description:
chromosome 9 open reading frame 95 [Source:HGNC Symbol;Acc:26057]
Mouse Orthologue:
BC016495
Mouse Description:
cDNA sequence BC016495 Gene [Source:MGI Symbol;Acc:MGI:2147434]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17660 Essential Splice Site Available for shipment Available now
sa31340 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055259 Essential Splice Site 40 199 2 8
Genomic Location (Zv9):
Chromosome 3 (position 34684592)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34469788
GRCz11 3 34599296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCTYCTGCMCAACAGCTGTGTTATTTCTCAAGATAACTTTTTCAAG[G/A]TGCCATACTCGATTTWTATTAATATTCTGAATGTAAAWATGTTGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055259 Essential Splice Site 135 199 6 8
Genomic Location (Zv9):
Chromosome 3 (position 34683531)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34468727
GRCz11 3 34598235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCATTAAATGAAGTAAAACCATCTCTTTCATTTCTCTCTATTGGGCA[G/A]CTCCAGAGTCTATGTGCCTCCAGATCCGCCAGGCTACCTTGATAGCTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link