zgc:110046

Ensembl ID:
ENSDARG00000037909
ZFIN ID:
ZDB-GENE-050522-380
Description:
hypothetical protein LOC553583 [Source:RefSeq peptide;Acc:NP_001018397]
Human Orthologue:
C19orf52
Human Description:
chromosome 19 open reading frame 52 [Source:HGNC Symbol;Acc:25152]
Mouse Orthologue:
1810026J23Rik
Mouse Description:
RIKEN cDNA 1810026J23 gene Gene [Source:MGI Symbol;Acc:MGI:1917023]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33224 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055252 Nonsense 211 252 2 2
Genomic Location (Zv9):
Chromosome 3 (position 34267539)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34052735
GRCz11 3 34182243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCCTCCCGCTCTGGTGGCAACAGTCCCACCATCACCACAAATAACT[G/T]AAAGAAACGAAAAGCTGCATGAGGACTCATGGAAAGCTGTTGTGATGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link