wnt9b

Ensembl ID:
ENSDARG00000037889
ZFIN ID:
ZDB-GENE-080201-1
Description:
protein Wnt-9b [Source:RefSeq peptide;Acc:NP_001131132]
Human Orthologue:
WNT9B
Human Description:
wingless-type MMTV integration site family, member 9B [Source:HGNC Symbol;Acc:12779]
Mouse Orthologue:
Wnt9b
Mouse Description:
wingless-type MMTV integration site 9B Gene [Source:MGI Symbol;Acc:MGI:1197020]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20083 Nonsense Available for shipment Available now
sa16500 Nonsense Available for shipment Available now
sa26124 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055225 Nonsense 66 358 2 4
Genomic Location (Zv9):
Chromosome 3 (position 37570946)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37434306
GRCz11 3 37576164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTAAAGCGCACCTGAAGCAATGCGAGCAGATGACTCTGACGCGCCGG[C/T]AAAAGCGCCTGTGCCGTCGGGAACCAGGGCTGGCAGAGACTCTGCGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055225 Nonsense 221 358 4 4
Genomic Location (Zv9):
Chromosome 3 (position 37575181)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37438541
GRCz11 3 37580399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGTGGACTTAAGACTACTTGTAAGTGTCATGGTGTTTCCGGTTCATG[T/A]GCTGTAAGGACGTRCTGGAAGCAGCTCTCCCCGTTTCAAGACACAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055225 Nonsense 275 358 4 4
Genomic Location (Zv9):
Chromosome 3 (position 37575341)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37438701
GRCz11 3 37580559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGGGAAACAGAACTGGCGGGCCCTCGCCGCCACAGCATCACGCTTCCC[C/T]GACCCCGTCCCACTGAACTGGTGTTTCTGGAGGAGTCGCCCAGCTTCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link