bactin2

Ensembl ID:
ENSDARG00000037870
ZFIN IDs:
ZDB-GENE-000329-3, ZDB-GENE-051030-60, ZDB-GENE-051030-60
Description:
Actin, cytoplasmic 2Actin, cytoplasmic 2, N-terminally processed [Source:UniProtKB/Swiss-Prot;Acc:Q7
Human Orthologue:
ACTG1
Human Description:
actin, gamma 1 [Source:HGNC Symbol;Acc:144]
Mouse Orthologue:
Actg1
Mouse Description:
actin, gamma, cytoplasmic 1 Gene [Source:MGI Symbol;Acc:MGI:87906]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45150 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055194 Nonsense 218 375 4 6
ENSDART00000141737 Nonsense 218 375 4 6
ENSDART00000148290   None 128 5 6

The following transcripts of ENSDARG00000037870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 40522075)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40385435
GRCz11 3 40527293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACAGCTGAGAGGGAAATTGTCCGTGACATCAAGGAGAAGCTCTGCTA[T/A]GTGGCCCTTGACTTTGAGCAGGAGATGGGCACCGCTGCTTCCTCCTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link