zgc:92244

Ensembl ID:
ENSDARG00000037865
ZFIN ID:
ZDB-GENE-041114-174
Description:
battenin [Source:RefSeq peptide;Acc:NP_001007307]
Human Orthologue:
CLN3
Human Description:
ceroid-lipofuscinosis, neuronal 3 [Source:HGNC Symbol;Acc:2074]
Mouse Orthologue:
Cln3
Mouse Description:
ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20092 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055170 Nonsense 282 446 10 15
Genomic Location (Zv9):
Chromosome 3 (position 39581421)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39444781
GRCz11 3 39586639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTTGTTTCTGATAGATGACAAACACATCGGACCCCTAACCTTCACT[G/T]AGAAAAAATACATCATTAAGGTTAGACCTGCTTCGTGGATTAAGTTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link