zgc:101663

Ensembl ID:
ENSDARG00000037852
ZFIN ID:
ZDB-GENE-041114-149
Description:
Alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C [Source:UniProtKB/Swiss-Pro
Human Orthologue:
MGAT4C
Human Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative) [S
Mouse Orthologue:
Mgat4c
Mouse Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative) Ge

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32418 Nonsense Available for shipment Available now
sa608 Nonsense F2 line generated During 2018
sa32419 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055148 Nonsense 81 454 4 4
ENSDART00000114000 Nonsense 81 454 3 3
Genomic Location (Zv9):
Chromosome 23 (position 408707)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 379698
GRCz11 23 392491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTGTGTGATATGTTTATTCAGAGTACCTCACGGTGGGCTTGTCGT[C/A]GGTGAGAAGAGAGAAGGGGTTTTACCTCCATGACACCCTGCAATCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa608
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055148 Nonsense 289 454 4 4
ENSDART00000114000 Nonsense 289 454 3 3
Genomic Location (Zv9):
Chromosome 23 (position 409332)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 380323
GRCz11 23 393116
KASP Assay ID:
554-0518.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAAAGTCATCCGCTTCCGGCCGTCTTTGTTCCAACACATGGGMACGTA[T/A]TCGTCATTTCGGGGAACGTACAATCGCTTAAAAGATGAGGACTTTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055148 Nonsense 426 454 4 4
ENSDART00000114000 Nonsense 426 454 3 3
Genomic Location (Zv9):
Chromosome 23 (position 409742)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 380733
GRCz11 23 393526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAATGAAGAGGGGGTTCAGAAGCTGCTGCCGGACGCTGTGGTGTGTT[T/A]ACGCATCAGAGTCACCGCTGCTCAACCTGAGTGGGTGATTATTAGCAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link