UNKL

Ensembl ID:
ENSDARG00000037838
Description:
unkempt homolog (Drosophila)-like [Source:HGNC Symbol;Acc:14184]
Human Orthologue:
UNKL
Human Description:
unkempt homolog (Drosophila)-like [Source:HGNC Symbol;Acc:14184]
Mouse Orthologues:
AC122826.1, Unkl
Mouse Description:
unkempt-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1921404]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31354 Essential Splice Site Available for shipment Available now
sa31355 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003338 Essential Splice Site 281 756 6 15
Genomic Location (Zv9):
Chromosome 3 (position 45828563)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47838116
GRCz11 3 45790450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGCCAGTACTGCCACTCTCGCACCGAACAGCAGTTCCACCCAGAGG[T/G]CAGGCTCACACACACCTGTACAACACTCTCCTTCAATGACTGACTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003338 Nonsense 474 756 11 15
Genomic Location (Zv9):
Chromosome 3 (position 45843721)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47853274
GRCz11 3 45805608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTCTCTCGACAAAGAGCTAGAGGACCAAGACAACAATGGCCTTGCTT[T/A]AACAAGTAAGTGTTCTTTGTCAATGTTTGTAGTTTGGTCCTTGGTTTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link