zgc:85727

Ensembl ID:
ENSDARG00000037832
ZFIN IDs:
ZDB-GENE-040426-2426, ZDB-GENE-040426-2426
Description:
hypothetical protein LOC406553 [Source:RefSeq peptide;Acc:NP_998434]
Human Orthologue:
KLHDC3
Human Description:
kelch domain containing 3 [Source:HGNC Symbol;Acc:20704]
Mouse Orthologue:
Klhdc3
Mouse Description:
kelch domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2651568]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38976 Nonsense Mutation detected in F1 DNA During 2018
sa10655 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055123   None 225 None 6
ENSDART00000126014 Nonsense 247 310 6 7
Genomic Location (Zv9):
Chromosome 13 (position 53653699)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51777106
GRCz11 13 51988407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCCTCCTCCAGTTGCCTA[T/G]AACGGAGAGCTCTACATCTTCGGTGGTTATAACGCTCGTCTGGATCGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055123   None 225 None 6
ENSDART00000126014 Nonsense 252 310 6 7
Genomic Location (Zv9):
Chromosome 13 (position 53653714)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51777121
GRCz11 13 51988422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTGTGTCCTCCTCCAGTTGCCTATAAYRGAGAGCTCTA[C/A]ATCTTCGGTGGTTATAACGCTCGTCTGGATCGACACTTTAACGACCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link