zgc:112393

Ensembl ID:
ENSDARG00000037777
ZFIN ID:
ZDB-GENE-050417-102
Description:
serine/threonine-protein kinase 16 [Source:RefSeq peptide;Acc:NP_001017630]
Human Orthologue:
STK16
Human Description:
serine/threonine kinase 16 [Source:HGNC Symbol;Acc:11394]
Mouse Orthologue:
Stk16
Mouse Description:
serine/threonine kinase 16 Gene [Source:MGI Symbol;Acc:MGI:1313271]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38240 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055047 Essential Splice Site 220 306 7 8
ENSDART00000142248   None 68 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4320446)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4733487
GRCz11 1 5431292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCTCTAGTGTTACGTCTGTAACTTGTATGTTGTTTTTCTGCCTGTA[G/T]TCTCTAGGTTGTGTGCTGTACTGTATGATGATGCTGGAGGGACCATATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link