slc43a1b

Ensembl ID:
ENSDARG00000037748
ZFIN ID:
ZDB-GENE-070209-173
Description:
large neutral amino acids transporter small subunit 3 [Source:RefSeq peptide;Acc:NP_001076469]
Human Orthologue:
SLC43A1
Human Description:
solute carrier family 43, member 1 [Source:HGNC Symbol;Acc:9225]
Mouse Orthologue:
Slc43a1
Mouse Description:
solute carrier family 43, member 1 Gene [Source:MGI Symbol;Acc:MGI:1931352]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19549 Essential Splice Site Available for shipment Available now
sa31225 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081835 Essential Splice Site 339 549 10 15
Genomic Location (Zv9):
Chromosome 1 (position 45061566)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43904785
GRCz11 1 44606088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTTTTTTTAGCCTCTGAGGTGTTGGTGAAGGAGTCAGAAGAGCAAG[G/A]TAAGAAAAAACACGCTATTTTCAAATTTCATCAATTTTGGTTTTAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081835 Essential Splice Site 493 549 14 15
Genomic Location (Zv9):
Chromosome 1 (position 45050373)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43893592
GRCz11 1 44594895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACTTTTCATGTTGATGTTGGGACCATTAAAGGGAGATCCTTACTGGG[T/C]GAGTCAAGTCATTTTTATTTCTATAGCGCTTAATTCTATGGTCTGTTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link