zgc:112980

Ensembl ID:
ENSDARG00000037739
ZFIN ID:
ZDB-GENE-050306-1
Description:
hypothetical protein LOC503706 [Source:RefSeq peptide;Acc:NP_001013318]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25521 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054981 Nonsense 407 715 13 21
ENSDART00000135197   None 229 None 6

The following transcripts of ENSDARG00000037739 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 7622844)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7862649
GRCz11 1 8546760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGATAACACACAAATGAGTGTTATTTGTGTGTTAAGGTTGGAGACTA[C/A]ACGGGTGCAGTCCAAACCATGTTATCCCCAATGCTTGGTGCTCCTTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link