zgc:55695

Ensembl ID:
ENSDARG00000037708
ZFIN ID:
ZDB-GENE-040426-781
Description:
exosome component 10 [Source:RefSeq peptide;Acc:NP_957383]
Human Orthologue:
EXOSC10
Human Description:
exosome component 10 [Source:HGNC Symbol;Acc:9138]
Mouse Orthologue:
Exosc10
Mouse Description:
exosome component 10 Gene [Source:MGI Symbol;Acc:MGI:1355322]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39400 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43927 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24276 Nonsense Available for shipment Available now
sa24277 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054915 Essential Splice Site 128 499 3 27
ENSDART00000137410 Essential Splice Site 128 899 3 25
Genomic Location (Zv9):
Chromosome 23 (position 14886368)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15018301
GRCz11 23 14774378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTTTGACCTGGTGGTGGACGCAAATGATGCCATCCTGGAGAAAGTGG[T/A]ACGAGTCTCTCACTGACACGCACACATCGCTGAAGTTCTGGTTCAGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054915 Essential Splice Site None 499 21 27
ENSDART00000137410 Essential Splice Site 744 899 20 25
Genomic Location (Zv9):
Chromosome 23 (position 14908722)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15040655
GRCz11 23 14796732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGCTCAGGCCAAACAGCAAGCTAAAGAACAGGCCAAGAAAGCTCAAG[G/A]TACAAACAACACAACTCTGGTGTGCAACGCTAAAATAAACTCTCTTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054915   None 499 22 27
ENSDART00000137410 Nonsense 747 899 21 25
Genomic Location (Zv9):
Chromosome 23 (position 14911288)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15043221
GRCz11 23 14799298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTTAAGATTTATGTCCTAAAATGTTTATATTTGTGTTTCAGAGGAA[C/T]GAAAGAAAGCCAAACAGACCTACCAAGAGTCGCTTCAGAACGTTCACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054915   None 499 24 27
ENSDART00000137410 Nonsense 861 899 23 25
Genomic Location (Zv9):
Chromosome 23 (position 14912020)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15043953
GRCz11 23 14800030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACACAGGTAAATCAAAAGACGGCTCACACTTTGATCCAAACAGACAA[G/T]GACCCAAGCAGAAGGTATGAAGTTCTGTTGTTTACACTGCTCCACTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link