
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gss
- Ensembl ID:
- ENSDARG00000037706
- ZFIN ID:
- ZDB-GENE-041010-208
- Description:
- glutathione synthetase [Source:RefSeq peptide;Acc:NP_001006104]
- Human Orthologue:
- GSS
- Human Description:
- glutathione synthetase [Source:HGNC Symbol;Acc:4624]
- Mouse Orthologue:
- Gss
- Mouse Description:
- glutathione synthetase Gene [Source:MGI Symbol;Acc:MGI:95852]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43926 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12621 | Essential Splice Site | Available for shipment | Available now |
sa12631 | Essential Splice Site | Available for shipment | Available now |
sa29894 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa688 | Nonsense | Available for shipment | Available now |
sa37644 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43926
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054909 | Nonsense | 12 | 475 | 2 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 14878844)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 15010777 GRCz11 23 14766854 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGCAGATTTAGTACTATGTCTGTCAAACTGGAGGACACCCTGAAAGAT[G/T]AAAACCTGATCAAACGTTTAGAGGAGATAGCAAAAGACACGGCGCTGTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12621
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054909 | Essential Splice Site | 43 | 475 | 2 | 13 |
ENSDART00000054909 | Essential Splice Site | 43 | 475 | 2 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 14878748)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 15010681 GRCz11 23 14766758 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTACATGGAGTGTTGATGCGGACCRAAGAYACGCCAAACTCTCCTGAA[G/A]TAAGAGAAYGTCTTTATCTACTTAGAAATATAATAAAGAAATGCATGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12631
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054909 | Essential Splice Site | 43 | 475 | 2 | 13 |
ENSDART00000054909 | Essential Splice Site | 43 | 475 | 2 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 14878748)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 15010681 GRCz11 23 14766758 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTACATGGAGTGTTGATGCGGACCRAAGAYACGCCAAACTCTCCTGAA[G/A]TAAGAGAAYGTCTTTATCTACTTAGAAATATAATAAAGAAATGCATGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29894
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054909 | Essential Splice Site | 118 | 475 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 14875375)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 15007308 GRCz11 23 14763385 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGTTATATAGATGTAAATCTTAATTTATTTAACTCCTCTTTCATTCAA[G/A]AAAATAGTAGTGGGTCTGAATCGCTCAGACTACATGTTAGACCACAGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa688
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054909 | Nonsense | 158 | 475 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 14875254)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 15007187 GRCz11 23 14763264 - KASP Assay ID:
- 554-0596.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCAGATTGAAATCAACACTATTGCTGCGAGTTTTGGTGGTCTTGCTTCA[C/T]GAACACCAGATGTCCATCGGTAAGTCTGACCATACATTTTAAGTGGACCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37644
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054909 | Essential Splice Site | 164 | 475 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 23 (position 14875233)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 15007166 GRCz11 23 14763243 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCTGCGAGTTTTGGTGGTCTTGCTTCACGAACACCAGATGTCCATCGG[T/G]AAGTCTGACCATACATTTTAAGTGGACCTATTATGCAAAAAAAAAATCAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Hemostatic factors and hematological phenotypes: Genome wide association study for plasma levels of natural anticoagulant inhibitors and protein C anticoagulant pathway: the MARTHA project. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: