zgc:158791

Ensembl ID:
ENSDARG00000037607
ZFIN ID:
ZDB-GENE-070112-1702
Description:
hypothetical protein LOC791170 [Source:RefSeq peptide;Acc:NP_001074121]
Human Orthologue:
C20orf112
Human Description:
chromosome 20 open reading frame 112 [Source:HGNC Symbol;Acc:16106]
Mouse Orthologue:
8430427H17Rik
Mouse Description:
RIKEN cDNA 8430427H17 gene Gene [Source:MGI Symbol;Acc:MGI:1918765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43938 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32436 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054761 Essential Splice Site None 455 1 8
Genomic Location (Zv9):
Chromosome 23 (position 17391831)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17294770
GRCz11 23 17221113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAACGAGGGGAGACCCTAGAAGAATATTAACAGCACACCCGCGAAG[G/A]TAAGGATTCAATTAGACTGGCATGACTTCATTATTTTAAATAGCAACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054761 Essential Splice Site 154 455 3 8
Genomic Location (Zv9):
Chromosome 23 (position 17509935)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17412874
GRCz11 23 17339217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACAGAGCTGCGCCTTGACAGAGACATCAGGGACTACAACAACAAGG[T/C]ACATACATTTGCTTATGCTAAAACGGTGATCAAAATAACATCCATGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link