slco1f1

Ensembl ID:
ENSDARG00000037605
ZFIN ID:
ZDB-GENE-040426-2192
Description:
solute carrier organic anion transporter family, member 1F1 [Source:RefSeq peptide;Acc:NP_998082]
Human Orthologue:
SLCO1C1
Human Description:
solute carrier organic anion transporter family, member 1C1 [Source:HGNC Symbol;Acc:13819]
Mouse Orthologue:
Slco1c1
Mouse Description:
solute carrier organic anion transporter family, member 1c1 Gene [Source:MGI Symbol;Acc:MGI:1889679]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25314 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30868 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109380 Essential Splice Site 410 565 8 12
Genomic Location (Zv9):
Chromosome 5 (position 62641850)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70581757
GRCz11 4 72097427
KASP Assay ID:
554-7493.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTTGCCATGCGGGCTGCAATTCCACCCAGGGTGCAGGATGGAATAAG[G/A]TGAATGCAGCGAATAACAATCTTACACTATCTCCTTCAATTATTACATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109380 Nonsense 544 565 12 12
Genomic Location (Zv9):
Chromosome 5 (position 62646140)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70577467
GRCz11 4 72093096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATTTGCCCCTATAAGGTTCCTCTTTCAGGGAATGACCATCGGCCTT[C/T]GAGTATTAGCCTGTTCCGTGCTCTGGATAGCCACCATAGAGATAAAGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link