st3gal5

Ensembl ID:
ENSDARG00000037556
ZFIN ID:
ZDB-GENE-060322-1
Description:
lactosylceramide alpha-2,3-sialyltransferase [Source:RefSeq peptide;Acc:NP_955810]
Human Orthologue:
ST3GAL5
Human Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 5 [Source:HGNC Symbol;Acc:10872]
Mouse Orthologue:
St3gal5
Mouse Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1339963]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22430 Nonsense Available for shipment Available now
sa9293 Nonsense Mutation detected in F1 DNA During 2018
sa38981 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054690 Nonsense 137 364 4 7
ENSDART00000135449   None 41 None 3
ENSDART00000137274 Nonsense 83 183 4 6

The following transcripts of ENSDARG00000037556 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 9664946)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9186786
GRCz11 14 9492800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAACCTCTTACCAGTTTCTTCTGAACAGAGGCTTGGGGAGCGAGATTG[T/A]CGACGCTGTGTAGTGGTTGGGAATGGAGGGATACTGAAAGGATTAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054690 Nonsense 250 364 6 7
ENSDART00000135449   None 41 None 3
ENSDART00000137274   None 183 None 6

The following transcripts of ENSDARG00000037556 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 9667271)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9189111
GRCz11 14 9495125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGTTTTTCTGGCAGAACGTGCCAATGAGCRTTCCAGTCAAGACCTCC[C/T]AGTTTCATCTCCTGAATCCCCAGATTATYCGTGARATGGCDTTGGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054690 Nonsense 257 364 6 7
ENSDART00000135449   None 41 None 3
ENSDART00000137274   None 183 None 6

The following transcripts of ENSDARG00000037556 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 9667292)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9189132
GRCz11 14 9495146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAATGAGCGTTCCAGTCAAGACCTCCCAGTTTCATCTCCTGAATCCC[C/T]AGATTATCCGTGAGATGGCGTTGGATCTGCTTAATTATCCCGAGCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link