tnnc1b

Ensembl ID:
ENSDARG00000037539
ZFIN ID:
ZDB-GENE-040625-62
Description:
slow-specific troponin C [Source:RefSeq peptide;Acc:NP_001002085]
Human Orthologue:
TNNC1
Human Description:
troponin C type 1 (slow) [Source:HGNC Symbol;Acc:11943]
Mouse Orthologues:
AC154446.1, Tnnc1
Mouse Descriptions:
troponin C, cardiac/slow skeletal Gene [Source:MGI Symbol;Acc:MGI:98779]
troponin C, slow skeletal and cardiac muscles [Source:RefSeq peptide;Acc:NP_033419]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29906 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054664 Essential Splice Site 106 161 5 6
Genomic Location (Zv9):
Chromosome 23 (position 20400678)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20185785
GRCz11 23 20112128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGTTGGCCTCAAAATCTATTGCAAAACCACGTTTTATTGTCCTGTTA[A/C]GAAATGGAGATGGTTACATTGACTTGGATGAGCTGAAGAACATGCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link