slc35c2

Ensembl ID:
ENSDARG00000037517
ZFIN ID:
ZDB-GENE-030131-2202
Description:
solute carrier family 35 member C2 [Source:RefSeq peptide;Acc:NP_997808]
Human Orthologue:
COL20A1
Human Description:
collagen, type XX, alpha 1 [Source:HGNC Symbol;Acc:14670]
Mouse Orthologue:
Col20a1
Mouse Description:
collagen, type XX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1920618]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37676 Nonsense Mutation detected in F1 DNA During 2018
sa37677 Nonsense Available for shipment Available now
sa37678 Nonsense Mutation detected in F1 DNA During 2018
sa18513 Nonsense Available for shipment Available now
sa10366 Nonsense Available for shipment Available now
sa45794 Nonsense Mutation detected in F1 DNA During 2018
sa24303 Missense, Nonsense Available for shipment Available now
sa43958 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641 Nonsense 341 1816 10 51
ENSDART00000102963 Nonsense 341 1816 10 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 341 1897 10 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20739763)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20524870
GRCz11 23 20451213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACTAACACATTCACGATGGCCCACATCTCTCCTCTCGTCCTCCCAGAG[C/T]GAATGACAATCTTCCTGGTGACTGTTCTCCTGATACTGGTTTCTGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641 Nonsense 733 1816 18 51
ENSDART00000102963 Nonsense 733 1816 18 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 733 1897 18 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20767496)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20552603
GRCz11 23 20478946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCAGAGTTGAGGCAGGTGGCGTCTGAACCTCTGGAGCTGAATGTGTA[T/G]AAGGTGAATGATTTTCCTCTGCTCAGTAAACTGGTGGGAAAACTAGCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641 Nonsense 805 1816 19 51
ENSDART00000102963 Nonsense 805 1816 19 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 805 1897 19 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20767800)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20552907
GRCz11 23 20479250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGAGAGTTGCGTCTGCGCTGGACCGTCCCCAGCAGAAATCCCCAG[C/T]AATACAGAGTGGTTTACCACACCGCTGAAGGACAGAGCCTTAATGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641 Nonsense 1051 1816 25 51
ENSDART00000102963 Nonsense 1051 1816 25 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 1051 1897 25 50
ENSDART00000140219   None 187 None 6
ENSDART00000054641 Nonsense 1051 1816 25 51
ENSDART00000102963 Nonsense 1051 1816 25 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 1051 1897 25 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20776106)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20561213
GRCz11 23 20487556
KASP Assay ID:
2261-7594.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGCTGCTCAYATGTGTTTGATCTTTCAGTRAGGGTTCCAGCTCCAT[C/A]AGATCTKAGGGTCACTAACTTCACCGGCAGTGAGATAACAGTACGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641 Nonsense 1051 1816 25 51
ENSDART00000102963 Nonsense 1051 1816 25 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 1051 1897 25 50
ENSDART00000140219   None 187 None 6
ENSDART00000054641 Nonsense 1051 1816 25 51
ENSDART00000102963 Nonsense 1051 1816 25 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 1051 1897 25 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20776106)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20561213
GRCz11 23 20487556
KASP Assay ID:
2261-7594.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGCTGCTCACATGTGTTTGATCTTTCAGTRAGGGTTCCAGCTCCAT[C/A]AGATCTGAGGGTCACTAACTTCACCGGCAGTGAGATAACAGTACGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641 Nonsense 1722 1816 45 51
ENSDART00000102963 Nonsense 1722 1816 45 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 1722 1897 45 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20796026)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20581133
GRCz11 23 20507476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGTTATTTTTCCCTTTTCAAAGGGTCTTCCTGGAAGTAAAGGTGAA[C/T]GAGGAGAGAAGGTGTGTTACAAAATGGCATGTCTAAGGAATACAAACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641 Nonsense 1807 1816 48 51
ENSDART00000102963 Nonsense 1807 1816 47 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Missense 1808 1897 47 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20796507)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20581614
GRCz11 23 20507957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGGTCGACTGGGAAGCAGAGGGATGCCTGGGAAACCTGGTTATCCTG[G/A]AGAGCAAGGTAACCCTTGATACTTGCATTTCTTTGGAGATGCAGGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054641   None 1816 50 51
ENSDART00000102963   None 1816 49 50
ENSDART00000109899   None 362 None 10
ENSDART00000132920 Nonsense 1883 1897 49 50
ENSDART00000140219   None 187 None 6

The following transcripts of ENSDARG00000037517 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20798251)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20583358
GRCz11 23 20509701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGGGAGAAATGGGACCCTCGGGTGTTTGTGACAGCAGTGGATGTTA[T/A]CAAGGGCCTCCTGCAGGTGAAAAAAAAAGCTATCCCAGATATTATTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link