
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gria4a
- Ensembl ID:
- ENSDARG00000037496
- ZFIN ID:
- ZDB-GENE-020125-7
- Description:
- glutamate receptor, ionotropic, AMPA 4a [Source:RefSeq peptide;Acc:NP_999971]
- Human Orthologue:
- GRIA4
- Human Description:
- glutamate receptor, ionotrophic, AMPA 4 [Source:HGNC Symbol;Acc:4574]
- Mouse Orthologue:
- Gria4
- Mouse Description:
- glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35998 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35998
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000042083 | Essential Splice Site | 157 | 898 | 3 | 16 |
ENSDART00000054599 | Essential Splice Site | 157 | 898 | 3 | 16 |
- Genomic Location (Zv9):
- Chromosome 15 (position 43526519)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 44736178 GRCz11 15 44755719 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACCACTATGACTGGAGCCGCTTCGTGTTCCTGTACGACACCGACAGAG[G/T]TAAAGACACACACATGCATACACCTTTATCAGCTGTACTGAAGAGGAGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: