sorbs3

Ensembl ID:
ENSDARG00000037476
ZFIN ID:
ZDB-GENE-050327-1
Description:
vinexin [Source:RefSeq peptide;Acc:NP_001014312]
Human Orthologue:
SORBS3
Human Description:
sorbin and SH3 domain containing 3 [Source:HGNC Symbol;Acc:30907]
Mouse Orthologue:
Sorbs3
Mouse Description:
sorbin and SH3 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:700013]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41265 Nonsense Mutation detected in F1 DNA During 2018
sa13984 Nonsense Available for shipment Available now
sa15686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054559   None 564 None 18
ENSDART00000112991 Nonsense 119 261 2 4
ENSDART00000127830 Nonsense 134 308 3 5
ENSDART00000129597   None 577 None 21
ENSDART00000132077   None 160 None 8
ENSDART00000134100   None 248 None 7
ENSDART00000134283   None 617 None 18
ENSDART00000146378   None 199 None 10
Genomic Location (Zv9):
Chromosome 8 (position 39494111)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38372914
GRCz11 8 38405853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACAAACTCACCACTTTACGCGGCAGTTGTAGTTCCCGTGAACACTTG[T/A]CGACCTGGCTCAGATATTCAGTTTTGGTTGAAGAAGAATGGCTGTCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054559   None 564 None 18
ENSDART00000112991 Nonsense 166 261 2 4
ENSDART00000127830 Nonsense 181 308 3 5
ENSDART00000129597   None 577 None 21
ENSDART00000132077   None 160 None 8
ENSDART00000134100   None 248 None 7
ENSDART00000134283   None 617 None 18
ENSDART00000146378   None 199 None 10
Genomic Location (Zv9):
Chromosome 8 (position 39493972)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38372775
GRCz11 8 38405714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGCCCTGAATGTCAAGTGGCCMATTTGGGCAATTMTTGACRTCTATGGA[C/T]AGACCACAAKGGTGACGATGCTTGGTGAGGCTTTTTTGARTTTTCAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054559 Nonsense 326 564 15 18
ENSDART00000112991   None 261 None 4
ENSDART00000127830   None 308 None 5
ENSDART00000129597 Nonsense 457 577 17 21
ENSDART00000132077   None 160 None 8
ENSDART00000134100   None 248 None 7
ENSDART00000134283 Nonsense 379 617 15 18
ENSDART00000146378   None 199 None 10
Genomic Location (Zv9):
Chromosome 8 (position 39417688)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38296491
GRCz11 8 38329430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTCAGGGTGAGGTGATCTCCATCACCAGGCGTGTTGATGATCATTG[G/A]CTGGAAGGTCGTATTGCTGGCACCACCCGCAGTGGAATCTTCCCTATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link