zgc:136652

Ensembl ID:
ENSDARG00000037455
ZFIN ID:
ZDB-GENE-060616-129
Description:
2-hydroxyacylsphingosine 1-beta-galactosyltransferase [Source:RefSeq peptide;Acc:NP_001037790]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18467 Essential Splice Site Available for shipment Available now
sa39599 Nonsense Mutation detected in F1 DNA During 2018
sa8667 Nonsense Mutation detected in F1 DNA During 2018
sa39598 Nonsense Mutation detected in F1 DNA During 2018
sa11773 Nonsense Available for shipment Available now
sa38257 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054510 Essential Splice Site None 542 None 7
ENSDART00000124770 Essential Splice Site None 541 None 6
Genomic Location (Zv9):
Chromosome 1 (position 19374928)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19900687
GRCz11 1 20593624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGGACGTCAGTTTCACACTCATTCGGAMACCGTGTTCACCTGGACAGG[T/G]AAGCGKTCRAGGGCGGCGTTTCCGATWAGCAACAGGTGTTCCGCRCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054510 Nonsense 13 542 2 7
ENSDART00000124770 Nonsense 13 541 2 6
Genomic Location (Zv9):
Chromosome 1 (position 19363173)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19888932
GRCz11 1 20581869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTGCAGTCATGAAGGCTTTTTTTGTGCTTGCCACATTGCTGTGGTG[T/A]TTAGCGACAAGTTTATCCTGGGCAGCCAAGATTGTGGTAGTTCCTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054510 Nonsense 193 542 2 7
ENSDART00000124770 Nonsense 193 541 2 6
Genomic Location (Zv9):
Chromosome 1 (position 19362635)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19888394
GRCz11 1 20581331
KASP Assay ID:
2259-0469.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTATGTCCCGGAATTTAACTCTCTACTAACGGACCATATGTCGTTGTTT[C/T]AAYGGGYAGCTAACACAGCRGTGTACCTAGTTTCCAGGTTTGGTGTCCAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054510 Nonsense 253 542 2 7
ENSDART00000124770 Nonsense 253 541 2 6
Genomic Location (Zv9):
Chromosome 1 (position 19362455)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19888214
GRCz11 1 20581151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACAGTCGACTCTGGATGCTGTGTACTGACATGGCACTGGAGTTCCCA[C/T]GACCAACTTTGCCACATGTTGTCTATGTAGGGGGCATCCTCACTAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054510 Nonsense 318 542 3 7
ENSDART00000124770 Nonsense 318 541 3 6
Genomic Location (Zv9):
Chromosome 1 (position 19357675)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19883434
GRCz11 1 20576371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGATGACATTGCTCAGAAACTCGCTGGAGCCTTGAGCCGTCTGCCC[C/T]AGAGAGTCATCTGGAGGTACTGCCATTCATTCGTTCTCTCATGTGATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054510 Essential Splice Site 349 542 4 7
ENSDART00000124770 Essential Splice Site 349 541 4 6
Genomic Location (Zv9):
Chromosome 1 (position 19350845)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19876604
GRCz11 1 20569541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAACAATACTAAACTAGTGGACTGGATGCCACAGAACGACTTGCTGGG[T/C]AAGTATTCATTCTATCACTTTTACAGATCGATAGAATTTTTATTTAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link