
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fmr1
- Ensembl ID:
- ENSDARG00000037433
- ZFIN ID:
- ZDB-GENE-020731-6
- Description:
- fragile X mental retardation 1 [Source:RefSeq peptide;Acc:NP_694495]
- Human Orthologue:
- FMR1
- Human Description:
- fragile X mental retardation 1 [Source:HGNC Symbol;Acc:3775]
- Mouse Orthologue:
- Fmr1
- Mouse Description:
- fragile X mental retardation syndrome 1 homolog Gene [Source:MGI Symbol;Acc:MGI:95564]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa992 | Nonsense | Available for shipment | Available now |
hu2787 | Nonsense | Available for shipment | Available now |
sa10402 | Essential Splice Site | Available for shipment | Available now |
sa19080 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
hu2898 | Essential Splice Site | Confirmed mutation in F2 line | Unknown |
sa22461 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa992
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054473 | Nonsense | 40 | 493 | 3 | 15 |
ENSDART00000054476 | Nonsense | 40 | 569 | 3 | 15 |
ENSDART00000123434 | Nonsense | 40 | 569 | 3 | 16 |
ENSDART00000129431 | Nonsense | 40 | 492 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 21160395)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 19861883 GRCz11 14 20159128 - KASP Assay ID:
- 554-0896.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGGTAAAATATATTCCCATATTTTATCACTATGCAGTTGGCAGCCAGAA[C/T]GACAGATTTCTTTCCAGGATGTTCGGTTTCCACCTCCAACCGGTTTTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- hu2787
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054473 | Nonsense | 113 | 493 | 5 | 15 |
ENSDART00000054476 | Nonsense | 113 | 569 | 5 | 15 |
ENSDART00000123434 | Nonsense | 113 | 569 | 5 | 16 |
ENSDART00000129431 | Nonsense | 113 | 492 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 21161310)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 19862798 GRCz11 14 20160043 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCAGCCTGTGATGCCACCCTAAATGAAATCGTCACATTAGAGAGGCTA[C/T]GACCTGTGAACCCCAACAAAGCAGCAACAAAGAACACCTTTCTCAAAACC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa10402
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054473 | Essential Splice Site | 140 | 493 | 5 | 15 |
ENSDART00000054476 | Essential Splice Site | 140 | 569 | 5 | 15 |
ENSDART00000123434 | Essential Splice Site | 140 | 569 | 5 | 16 |
ENSDART00000129431 | Essential Splice Site | 140 | 492 | 5 | 14 |
ENSDART00000054473 | Essential Splice Site | 140 | 493 | 5 | 15 |
ENSDART00000054476 | Essential Splice Site | 140 | 569 | 5 | 15 |
ENSDART00000123434 | Essential Splice Site | 140 | 569 | 5 | 16 |
ENSDART00000129431 | Essential Splice Site | 140 | 492 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 21161394)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 19862882 GRCz11 14 20160127 - KASP Assay ID:
- 2260-7454.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACACCTTTCTCAAAACCAGACTAGATGTWCCTGAAGACTTGAGACAGATG[T/A]AAGTTGGTAGCTTTTTCATTATTTTAGTGGGGATTCCTGCAGCATTGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19080
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054473 | Essential Splice Site | 140 | 493 | 5 | 15 |
ENSDART00000054476 | Essential Splice Site | 140 | 569 | 5 | 15 |
ENSDART00000123434 | Essential Splice Site | 140 | 569 | 5 | 16 |
ENSDART00000129431 | Essential Splice Site | 140 | 492 | 5 | 14 |
ENSDART00000054473 | Essential Splice Site | 140 | 493 | 5 | 15 |
ENSDART00000054476 | Essential Splice Site | 140 | 569 | 5 | 15 |
ENSDART00000123434 | Essential Splice Site | 140 | 569 | 5 | 16 |
ENSDART00000129431 | Essential Splice Site | 140 | 492 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 21161394)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 19862882 GRCz11 14 20160127 - KASP Assay ID:
- 2260-7454.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACCTTTCTCAAAACCAGACTAGATGTTCCTGAAGACTTGAGACAGATG[T/A]AAGTTGGTAGCTTTTTCATTATTTTAGTGGGGATTCCTGCAGCATTGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- hu2898
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Unknown
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054473 | Essential Splice Site | 211 | 493 | 8 | 15 |
ENSDART00000054476 | Essential Splice Site | 211 | 569 | 8 | 15 |
ENSDART00000123434 | Essential Splice Site | 211 | 569 | 8 | 16 |
ENSDART00000129431 | Essential Splice Site | 211 | 492 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 21169096)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 19870584 GRCz11 14 20167829 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAGAATATTAAAAACAGGTAAGATTCAAAATCTTGTTATATCTTCATC[A/G]GAGTTCTCGGCAGCTGGCCTCAAGGTTTCATGAACAGTTTGTGGTGCGGG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa22461
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054473 | Nonsense | 389 | 493 | 12 | 15 |
ENSDART00000054476 | Nonsense | 389 | 569 | 12 | 15 |
ENSDART00000123434 | Nonsense | 389 | 569 | 12 | 16 |
ENSDART00000129431 | Nonsense | 389 | 492 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 21177110)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 19878598 GRCz11 14 20175843 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGATGAGCAGCTTAGACAGATCGGTGGAGGACCCAGAGCTTTGCCGGGA[C/T]GACCCGAGAAAGAAAAGTCTTTCATGGCTGATAATGGAATGGGACCCTCG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Antineutrophil cytoplasmic antibody-associated vasculitis : Genetically distinct subsets within ANCA-associated vasculitis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: