
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
haus7
- Ensembl ID:
- ENSDARG00000037432
- ZFIN ID:
- ZDB-GENE-050506-15
- Description:
- Im:6894757 protein [Source:UniProtKB/TrEMBL;Acc:Q1RM89]
- Human Orthologue:
- HAUS7
- Human Description:
- HAUS augmin-like complex, subunit 7 [Source:HGNC Symbol;Acc:32979]
- Mouse Orthologue:
- Haus7
- Mouse Description:
- HAUS augmin-like complex, subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1920988]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43952 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa29904 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43952
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111720 | Essential Splice Site | 151 | 384 | None | 12 |
ENSDART00000125066 | Essential Splice Site | 146 | 379 | None | 10 |
The following transcripts of ENSDARG00000037432 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20118697)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19903804 GRCz11 23 19830147 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGAGCAGCTTCTAAGGGTTATTCAAGCAGACTCCTCTCTGTGCTCTGGG[T/C]AACTCTTAAAGCATTTTGTAATAGTGATTTAACTAAATATGCTCTGATGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29904
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111720 | Essential Splice Site | 328 | 384 | 9 | 12 |
ENSDART00000125066 | Essential Splice Site | 323 | 379 | 9 | 10 |
The following transcripts of ENSDARG00000037432 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 20114499)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 19899606 GRCz11 23 19825949 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTTTGCTTATTCAAATACAAATACTTAGCATTTTCTTTGTGTCCTTTTC[A/G]GGAGCTGGAGGCTGTGAAGCAGCTTTCTGAAACTTCCACGTCTCTTACAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: