zgc:162925

Ensembl ID:
ENSDARG00000037422
ZFIN IDs:
ZDB-GENE-070424-95, ZDB-GENE-070424-95
Description:
hypothetical protein LOC567809 [Source:RefSeq peptide;Acc:NP_001103944]
Human Orthologues:
SLC6A15, SLC6A17
Human Descriptions:
solute carrier family 6 (neutral amino acid transporter), member 15 [Source:HGNC Symbol;Acc:13621]
solute carrier family 6, member 17 [Source:HGNC Symbol;Acc:31399]
Mouse Orthologues:
Slc6a15, Slc6a17
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter), member 15 Gene [Source:MGI Symbol;Acc:MGI:21
solute carrier family 6 (neurotransmitter transporter), member 17 Gene [Source:MGI Symbol;Acc:MGI:24

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44187 Nonsense Mutation detected in F1 DNA During 2018
sa32499 Nonsense Available for shipment Available now
sa24554 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018010 Nonsense 300 676 6 11
ENSDART00000076558 Nonsense 300 676 7 12
Genomic Location (Zv9):
Chromosome 24 (position 40144228)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38743149
GRCz11 24 38630912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGTGATTGCGTACTCTTCCTATAACCCACGAAACAACAACTGCCAT[C/T]GAGACGCGTTCACTGTGTCTGGAGTCAACTTCATGACGTCTGTTTTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018010 Nonsense 367 676 7 11
ENSDART00000076558 Nonsense 367 676 8 12
Genomic Location (Zv9):
Chromosome 24 (position 40141806)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38740727
GRCz11 24 38628490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTACCTGTCCTTTCCATCAATGCTTCAGATGTAGAGAGCATCTCAT[T/A]GGACGAGTATGCAAACTGGTACTCGACTCAAGGGATGGAGCTCAGTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018010 Essential Splice Site 520 676 9 11
ENSDART00000076558 Essential Splice Site 520 676 10 12
Genomic Location (Zv9):
Chromosome 24 (position 40136404)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38735325
GRCz11 24 38623088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCATCTTTCAGACCATCAGTGTTTCATGGGTTTATGGAGCAGACAG[G/A]TAAAACACACACACACACACACAATTCCATGCAAATGTCAACCTTCCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link