si:dkey-251e24.6

Ensembl ID:
ENSDARG00000037406
ZFIN ID:
ZDB-GENE-090313-277
Human Orthologue:
WDR19
Human Description:
WD repeat domain 19 [Source:HGNC Symbol;Acc:18340]
Mouse Orthologue:
Wdr19
Mouse Description:
WD repeat domain 19 Gene [Source:MGI Symbol;Acc:MGI:2443231]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32654 Nonsense Mutation detected in F1 DNA During 2018
sa17659 Essential Splice Site Available for shipment Available now
sa15311 Nonsense Available for shipment Available now
sa19481 Nonsense Available for shipment Available now
sa19480 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034477 Nonsense 363 1345 11 36
ENSDART00000131257 Nonsense 363 1345 11 37
ENSDART00000135905 Nonsense 57 241 2 7

The following transcripts of ENSDARG00000037406 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20312053)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20836464
GRCz11 1 21529401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCAAGCTGCCTATACTGGGAGACAGCAGTGGCACTAGAATTGCCTA[T/A]CTTACATCCCTGCTGGAGGTTACAGTCGCTAATCCAGTGGAAGGGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034477 Essential Splice Site 593 1345 16 36
ENSDART00000131257 Essential Splice Site 593 1345 16 37
ENSDART00000135905   None 241 None 7

The following transcripts of ENSDARG00000037406 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20308445)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20832856
GRCz11 1 21525793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAAGACAAAGTCTATACRTATGCYTTCCACAAAGACACYATACAAGG[T/C]AAAAATATATGAGTAAATGTTTTATTATAAATAAGTAMTAAAATTAGWGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034477 Nonsense 736 1345 19 36
ENSDART00000131257 Nonsense 736 1345 19 37
ENSDART00000135905 Nonsense 93 241 3 7

The following transcripts of ENSDARG00000037406 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20301399)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20825810
GRCz11 1 21518747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAAATTTGCTGGCGGGTCATTTGGCCAWGTTCTGCAATGACTACAAC[C/T]GAGCCCAGGACCTCWATCTAAYATCTTCATATCCTATGGCGGCCCTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034477 Nonsense 746 1345 19 36
ENSDART00000131257 Nonsense 746 1345 19 37
ENSDART00000135905 Nonsense 103 241 3 7

The following transcripts of ENSDARG00000037406 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20301367)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20825778
GRCz11 1 21518715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCAATGACTACAACCGAGCCCAGGACCTCTATCTAACATCTTCATA[T/A]CCTATGGCGGCCCTAGAGGTAAATTAGGCATGCAAACACACACATACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034477 Nonsense 879 1345 23 36
ENSDART00000131257 Nonsense 879 1345 23 37
ENSDART00000135905 Nonsense 236 241 7 7

The following transcripts of ENSDARG00000037406 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20298707)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20823118
GRCz11 1 21516055
KASP Assay ID:
554-6256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGCTGTATGAGAAAGGCCAGTACTATGACAAAGCTGCCTCTGTCTA[C/A]ATACGCTGTAAAAACTGGTAAAACAACATTATAGTAACAGTGACAATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link