zgc:112083

Ensembl ID:
ENSDARG00000037405
ZFIN ID:
ZDB-GENE-050417-284
Description:
MBD2 (methyl-CpG-binding protein)-interacting zinc finger protein [Source:RefSeq peptide;Acc:NP_001
Human Orthologue:
HINFP
Human Description:
histone H4 transcription factor [Source:HGNC Symbol;Acc:17850]
Mouse Orthologue:
Hinfp
Mouse Description:
histone H4 transcription factor Gene [Source:MGI Symbol;Acc:MGI:2429620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8518 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054428 Nonsense 366 504 9 10
Genomic Location (Zv9):
Chromosome 15 (position 18963189)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20065815
GRCz11 15 20001547
KASP Assay ID:
2260-8344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCCACCTGCGGAAGAAGCACCAGCTCAAATGGCCATCTGGACACTCT[C/T]GATTTAGGTAAGGTKAMATCAATAAATARTGGCTGAACTCCAGTCAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link