zgc:113229

Ensembl ID:
ENSDARG00000037398
ZFIN ID:
ZDB-GENE-050417-475
Description:
hypothetical protein LOC550612 [Source:RefSeq peptide;Acc:NP_001017913]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054417 Nonsense 110 632 2 6
ENSDART00000123225 Nonsense 110 632 1 5
ENSDART00000131258   None 222 None 4
Genomic Location (Zv9):
Chromosome 14 (position 22938163)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21637651
GRCz11 14 21934896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTAAAAAGCCTGCCAAAAGGATCACTAAACACTTAGCGTCTTCTGCT[A/T]AACCTAAACGTCCACCATTAATATGGGGAGAAAACAAGCGTTTTATCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link