ssrp1a

Ensembl ID:
ENSDARG00000037397
ZFIN ID:
ZDB-GENE-031118-9
Description:
structure specific recognition protein 1a [Source:RefSeq peptide;Acc:NP_997967]
Human Orthologue:
SSRP1
Human Description:
structure specific recognition protein 1 [Source:HGNC Symbol;Acc:11327]
Mouse Orthologue:
Ssrp1
Mouse Description:
structure specific recognition protein 1 Gene [Source:MGI Symbol;Acc:MGI:107912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31984 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106155 Nonsense 412 517 11 19
ENSDART00000137795 Nonsense 412 705 11 18
Genomic Location (Zv9):
Chromosome 14 (position 23003920)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21703408
GRCz11 14 22000653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCATAATTCAGAAATAATCCTCTCTTCTGCTTTAATAGGGAAGAATA[T/A]GGAAAACTTTTTGACTTTGTCAACGCCAAGAAGCTGACTATCAAGAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link