slc43a1a

Ensembl ID:
ENSDARG00000037393
ZFIN ID:
ZDB-GENE-030131-6327
Description:
solute carrier family 43, member 1a [Source:RefSeq peptide;Acc:NP_956191]
Human Orthologue:
SLC43A1
Human Description:
solute carrier family 43, member 1 [Source:HGNC Symbol;Acc:9225]
Mouse Orthologue:
Slc43a1
Mouse Description:
solute carrier family 43, member 1 Gene [Source:MGI Symbol;Acc:MGI:1931352]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31985 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054411 Nonsense 172 373 6 13
ENSDART00000106147 Nonsense 175 536 6 15

The following transcripts of ENSDARG00000037393 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 23091238)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21790728
GRCz11 14 22087973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAAACATGTTTGGAAGTCTGAGCTCCACTGTCATGTCACTTATGATT[G/T]GATCTTATGCGTCATCTGCTGTCACCTTTCCGGGAGTCAAGGTATTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link