st5

Ensembl ID:
ENSDARG00000037363
ZFIN ID:
ZDB-GENE-030131-2547
Description:
suppression of tumorigenicity 5 protein [Source:RefSeq peptide;Acc:NP_001002327]
Human Orthologue:
ST5
Human Description:
suppression of tumorigenicity 5 [Source:HGNC Symbol;Acc:11350]
Mouse Orthologue:
St5
Mouse Description:
suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20954 Nonsense Available for shipment Available now
sa40902 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054368 Nonsense 127 1129 3 21
ENSDART00000113313 Nonsense 127 1125 3 20
ENSDART00000133050 Nonsense 127 1125 2 19

The following transcripts of ENSDARG00000037363 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29853184)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28245707
GRCz11 7 28516900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGCCACCAAGTGGTGATAGGCAGGATCAGAAGGAGAATCAGCCACAA[C/T]AGACCCCCCCTATTGGGGATGGATTGAATACTGGACTGCTCAGCTTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054368 Essential Splice Site 1086 1129 None 21
ENSDART00000113313 Essential Splice Site 1086 1125 None 20
ENSDART00000133050 Essential Splice Site 1086 1125 None 19

The following transcripts of ENSDARG00000037363 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29803397)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28195920
GRCz11 7 28467113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTGGATTCATCCAGGACCGGGAGATGAGGAAGTGCAGGGCCAAAGG[T/A]AAACCAATAAAAACAAGACCACTTCTCATCAGATGTGATGTCCTGTTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link