zgc:73356

Ensembl ID:
ENSDARG00000037356
ZFIN ID:
ZDB-GENE-040426-1776
Description:
Mitochondrial import inner membrane translocase subunit Tim16 [Source:UniProtKB/Swiss-Prot;Acc:Q6PBL
Human Orthologue:
PAM16
Human Description:
presequence translocase-associated motor 16 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29679]
Mouse Orthologue:
Pam16
Mouse Description:
presequence translocase-asssociated motor 16 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40010 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44557 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054356 Essential Splice Site 1 129 1 5
Genomic Location (Zv9):
Chromosome 3 (position 12810649)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12199703
GRCz11 3 12352646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCGTCCTAAACCGAGCTGTATCCCATCACCACAGCTGTCCAACCATGG[T/A]ATGTTCAGAAATTCATATAATAATCTCTAGCGCTTTATGGTTTCTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054356 Nonsense 44 129 3 5
Genomic Location (Zv9):
Chromosome 3 (position 12813564)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12196788
GRCz11 3 12349731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAATCAGCCAGTCAGGCGGCTGCGGAGGCTCGAGGTCAAGCGGGCAGA[C/T]AGTCTGCGGCGGCGTCCAGTTTCACAGGAATGACCTTACAGGAAGCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link