si:dkey-30k22.7

Ensembl ID:
ENSDARG00000037286
ZFIN ID:
ZDB-GENE-090313-302
Human Orthologues:
CELSR1, CELSR2, CELSR3
Human Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologues:
Celsr1, Celsr2, Celsr3
Mouse Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19502 Nonsense Available for shipment Available now
sa19501 Nonsense Available for shipment Available now
sa39615 Nonsense Mutation detected in F1 DNA During 2018
sa9493 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032841   None 1091 None 11
ENSDART00000125204 Nonsense 94 107 2 2
ENSDART00000126068   None 189 None 2
ENSDART00000126076   None 644 None 2
ENSDART00000135763 Nonsense 716 1204 4 6
Genomic Location (Zv9):
Chromosome 1 (position 24488808)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24940579
GRCz11 1 25631408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCGGTCTACCTGAGCTCTTCTCTAATGCAGCTGCGCAGTAGCAGTGTG[A/T]AGCTGTCTGTTTCTGCTCGAGATGGAGGAGGCATGTCTGCTGCTTATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032841 Nonsense 362 1091 5 11
ENSDART00000125204   None 107 None 2
ENSDART00000126068   None 189 None 2
ENSDART00000126076   None 644 None 2
ENSDART00000135763   None 1204 None 6
Genomic Location (Zv9):
Chromosome 1 (position 24477397)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24929168
GRCz11 1 25619997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGTTTGCAGTTTGGCATTAAAAGTTCTAGTGGCGAGCTTTATGTGGCA[C/T]AACATCTGGACTACGAAGTCACTCAGCGTTACTTCCTGGTTGTACGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032841 Nonsense 403 1091 5 11
ENSDART00000125204   None 107 None 2
ENSDART00000126068   None 189 None 2
ENSDART00000126076   None 644 None 2
ENSDART00000135763   None 1204 None 6
Genomic Location (Zv9):
Chromosome 1 (position 24477273)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24929044
GRCz11 1 25619873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGTATTTGCTGCAGTCAGCATTCTCGATGTCAATGACCACAACCCCT[G/A]GTTCCCTAGCAATGGCAACATTGTGATATTTGGTGTTCATGAGGATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032841 Nonsense 444 1091 5 11
ENSDART00000125204   None 107 None 2
ENSDART00000126068   None 189 None 2
ENSDART00000126076   None 644 None 2
ENSDART00000135763   None 1204 None 6
Genomic Location (Zv9):
Chromosome 1 (position 24477149)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24928920
GRCz11 1 25619749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATGCACGAGATGGTGATGGAAGTCTACACTACAGTGAGCTTTATTA[T/G]TCTTTGACTTWCGACCCCAGCCCTGCCATTGAGGGGCTGCCTTTACACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link