zgc:77703

Ensembl ID:
ENSDARG00000037266
ZFIN ID:
ZDB-GENE-040426-1853
Description:
myozenin-2 [Source:RefSeq peptide;Acc:NP_957148]
Human Orthologue:
MYOZ2
Human Description:
myozenin 2 [Source:HGNC Symbol;Acc:1330]
Mouse Orthologue:
Myoz2
Mouse Description:
myozenin 2 Gene [Source:MGI Symbol;Acc:MGI:1913063]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054213 Nonsense 152 213 5 5
ENSDART00000128472 Nonsense 196 257 5 5
ENSDART00000136321 Nonsense 165 226 5 5
ENSDART00000145740   None 89 5 5
ENSDART00000146488 Nonsense 196 257 6 6
Genomic Location (Zv9):
Chromosome 1 (position 24775867)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25227638
GRCz11 1 25918467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGTTTCTCAGGGTTGCTACACCATTTGGCGGTTTCGAAAAAGCTCCA[C/T]GAGGAATCACCTTTAAGCTTCCAGAGATGGACTTGAATACTCCTCAATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link