si:dkeyp-110e4.3

Ensembl ID:
ENSDARG00000037246
ZFIN ID:
ZDB-GENE-070424-268
Description:
hypothetical protein LOC100151754 [Source:RefSeq peptide;Acc:NP_001120941]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18637 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054189 Nonsense 446 615 4 7
ENSDART00000148140 Nonsense 198 367 3 6
Genomic Location (Zv9):
Chromosome 14 (position 27405584)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26098381
GRCz11 14 26396486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATGAATTCCTTCTCGACTGCAAAGGGATTGTTCCAGAGGACAAGTTA[C/T]GAAAAATCATGTACCAGACAACAATTGCAGCCCAAACATGCTGCCAGCGK
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link