smad5

Ensembl ID:
ENSDARG00000037238
ZFIN ID:
ZDB-GENE-990603-9
Description:
Mothers against decapentaplegic homolog 5 [Source:UniProtKB/Swiss-Prot;Acc:Q9W7E7]
Human Orthologue:
SMAD1
Human Description:
SMAD family member 1 [Source:HGNC Symbol;Acc:6767]
Mouse Orthologues:
Smad1, Smad5
Mouse Descriptions:
MAD homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109452]
MAD homolog 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1328787]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14393 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054175 Nonsense 361 464 7 8
ENSDART00000129079 Nonsense 361 464 6 7
ENSDART00000145625   None 131 None 2
Genomic Location (Zv9):
Chromosome 14 (position 27478061)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26170858
GRCz11 14 26468963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGTTTGAGTGATACCAGCATTTTTGTCCAGAGTCGAAAYTGCAACTA[C/A]CATCATGGCTTTCACCCCACGACTGTCTGCAAAATCCCCAGCGGCTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link