ARID5B

Ensembl ID:
ENSDARG00000037196
Description:
AT rich interactive domain 5B (MRF1-like) [Source:HGNC Symbol;Acc:17362]
Human Orthologue:
ARID5B
Human Description:
AT rich interactive domain 5B (MRF1-like) [Source:HGNC Symbol;Acc:17362]
Mouse Orthologue:
Arid5b
Mouse Description:
AT rich interactive domain 5B (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2175912]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45451 Nonsense Mutation detected in F1 DNA During 2018
sa35214 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054092 Nonsense 467 1044 8 8
Genomic Location (Zv9):
Chromosome 12 (position 9136815)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8344770
GRCz11 12 8382613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCAACTCTCACACCTCGGACCAATGGAAGCATGGGATATTGGAATAC[A/T]AGGTACCTCCTAGTGCCCTTGCAAACGTTGAACAATCTAGGCCAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054092 Nonsense 581 1044 8 8
Genomic Location (Zv9):
Chromosome 12 (position 9137157)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8345112
GRCz11 12 8382955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCAGTAGAAGATTGTCCAGCAGTGGTACAGAAGTGTCATCTGCTGGA[C/T]AGTCGAGCTCCCAGGTTTCCTCCTCCGTAGAGACCAGCATAGTGATCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link